Skip to main content
Download PDF

Reduction of UreB and CagA expression level by siRNA construct in Helicobacter pylori strain SS1

BMC Microbiology volume 23, Article number: 401 (2023) Cite this article

Abstract

Background

Two important virulence factors, urease and cagA, play an important role in Helicobacter pylori (H. pylori) gastric cancer. Aim of this study was to investigate the expression level and function of ureB and cagA using small interfering RNAs (siRNA).

Methods

SS1 strain of H. pylori was considered as host for natural transformation. siRNA designed for ureB and cagA genes were inserted in pGPU6/GFP/Neo siRNA plasmid vector to evaluate using phenotypic and genotypic approaches. Then, qPCR was performed for determining inhibition rate of ureB and cagA gene expression.

Results

The expression levels of siRNA-ureB and siRNA-cagA in the recombinant strain SS1 were reduced by about 5000 and 1000 fold, respectively, compared to the native H. pylori strain SS1. Also, preliminary evaluation of siRNA-ureB in vitro showed inhibition of urea enzyme activity. These data suggest that siRNA may be a powerful new tool for gene silencing in vitro, and for the development of RNAi-based anti-H. pylori therapies.

Conclusion

Our results show that targeting ureB and cagA genes with siRNA seems to be a new strategy to inhibit urease enzyme activity, reduce inflammation and colonization rate.

Peer Review reports

Introduction

Helicobacter pylori (H. pylori) is a Gram-negative microaerophilic bacterium that colonizes the gastric mucosa of half of the world's population and causes various diseases, including peptic ulcer disease (PUD), gastric mucosa-associated lymphoid tissue (MALT) lymphoma, and gastric cancer [1]. The prevalence of PUD in people with H. pylori infection is estimated at 10% [2]. According to the World Health Organization (WHO), H. pylori is classified as a class I carcinogen for causing gastric cancer [3]. Gastric cancer is one of the major health challenges worldwide, accounting for approximately 754,000 deaths annually, and is the fourth leading cause of cancer-related deaths in both sexes [4]. Among the virulence factors of H. pylori that are important in the pathogenesis of stomach disease are urease, cytotoxin-associated gene A (CagA), Vacuolating cytotoxin A (VacA) and adhesion proteins [5]. Phenotypic and genotypic methods can be useful in the diagnosis of H. pylori. So that in phenotypic methods such as culture and antibiotic sensitivity testing, it may be a prerequisite for patients with persistent infection after initial or repeated treatment failure [6], and on the other hand, molecular methods provide the possibility of rapid diagnosis of this bacterium as well as determination of its genotype [7].

Urease plays an essential role in the pathogenesis of H. pylori and constitutes 10–15% of the total bacterium protein by weight. In 2001, it was shown that H. pylori urease consists of two structural proteins, α (61.7 kDa) and β (approximately 26.5 kDa) subunits, which are located in the outer membrane of the bacterium [8]. Successful colonization by this bacterium in the acidic condition of the stomach requires active urease, which hydrolyzes urea to produce ammonia and CO2, allowing H. pylori to colonize the gastric mucosa [9]. On the other hand, H. pylori induces cellular and humoral immune responses of the host to the site of infection, and this immune response provides nutrients for the stomach pathogen and ultimately enables continuous colonization of the stomach throughout the host's life [10, 11]. Various compounds have been used to inhibit H. pylori urease enzyme [12, 13]. UreB subunit is the most effective and common immunogen of H. pylori that can create a protective immune response in the body against this bacterium, so UreB is a very good reporter of in vivo gene expression [14]. Therefore, urease activity and stability are necessary for colonization by H. pylori in the human stomach.

CagA protein is a 128–145 kDa protein encoded by the cag pathogenicity island (cagPAI), which can be injected into gastric epithelial cells via the type IV secretion system (T4SS) [15, 16]. CagA protein directly targets the gastric epithelium and causes CagA-mediated carcinogenesis, while VacA protein promotes apoptosis and epithelial cell death [17]. Evidence has shown that CagA causes acute gastritis, peptic ulcer, and the development of gastric and VacA toxin increases the ability of bacteria to colonize the stomach and contributes to the pathogenesis of gastric adenocarcinoma and peptic ulcer disease [18,19,20]. In a prospective study, the risk of duodenal ulcer and gastric ulcer was increased by 18.4-fold and 2.9-fold in individuals infected with cagA-positive H. pylori strains, respectively [21]. CagA can affect the host cell in several different ways: 1) changing host signaling in both phosphorylation-dependent and independent ways (e.g.: phosphorylated CagA binds to SHP-2 phosphatase and affects cell adhesion, proliferation and migration 2) altering the cytoskeleton, 3) affecting cell proliferation, and 4) stimulating gastric epithelial cells to secrete interleukin-8 (IL-8) [22, 23]. IL-8 is a major neutrophil-activating cytokine and also one of the most important chemokines for H. pylori-induced chronic gastric inflammation [24].

Three decades ago researchers showed that small interfering RNAs (siRNAs) are double-stranded RNAs of 21–25 nucleotides that act as key effector molecules in triggering sequence-specific RNA degradation during post-transcriptional gene silencing [25]. Based on scientific evidence, siRNA molecules have been considered as potentially effective therapeutic targets for a wide range of diseases, including cancer, viral and bacterial infections [26, 27]. Meanwhile, five siRNA-based drugs (patisiran, givosiran, incilisiran, lumasiran, and veterisiran) have been approved by the Food and Drug Administration (FDA) and several powerful drugs are in the final stages of phase III clinical trials [28]. However, no study has been conducted on the inhibition of ureB and cagA virulence factors of H. pylori by siRNA. In Fig. 1, shows the effect of siRNA on urease and CagA virulence factors of H. pylori.

Fig. 1
figure 1

Effect of siRNA on Urease and CagA virulence factors of H. pylori. Urease is a critical factor that facilitates bacterial colonization in the gastric mucosa and hydrolyzes urea to produce ammonia and CO2. Proteins such as blood group antigen binding adhesin A (BabA), sialic acid–binding adhesin (SabA), and outer inflammatory protein A (OipA) produced by this pathogen contribute to colonization and persistence of infection. CagA protein directly targets gastric epithelium and CagA-mediated carcinogenesis occurs. In the siRNA pathway, full complementary binding between the siRNA guide strand and the target mRNA leads to mRNA cleavage. In other words, siRNA reduces or inhibits the expression level of ureB and cagA genes, which results in the reduction of colonization and inflammation. The figure is created using BioRender.com

Full size image

The aim of this study was to investigate the expression level and function of virulence factor ureB and cagA of H. pylori in the presence and absence of siRNA, which can be promising for the treatment of H. pylori infection and other diseases related to this bacterium.

Methods

Bacterial strain and growth condition

The SS1 H. pylori strain was kindly provided by Dr. Mohammad Ali Haghighi (Bushehr University of medical sciences, Iran). The strain was cultured on Luria–Bertani agar (LB) medium (Difco Laboratories, USA, Detroit, MI) supplemented with 8% fetal calf serum (FCS), 5 μl/ml trimethoprim (Sigma), 5 μl/ml vancomycin, 2.5 units/ml polymyxin B (Sigma) and 8 μl/ml amphotericin B (Sigma). The microaerophilic conditions (85% N2, 10% CO2, 5% O2) was prepared using Anoxomat system (Advanced Instruments, Inc., Norwood, USA, MA) and were incubated for 3–4 days at 37 °C. The workflow for this scientific study is shown in Fig. 2.

Fig. 2
figure 2

Flow chart of study design

Full size image

Obtaining small interfering RNAs

siRNA sequences against ureB and cagA genes were designed by siDirect 2.0 web server (http://siDirect2.RNAi.jp/), and after screening and BLAST (Basic Local Alignment Search Tool) analysis, the best siRNA was selected. This web server adjusted the parameters so that the siRNA candidates met the Ui-Tei, Reynolds and Amarzguioui (URA) criteria for improving specificity in in vitro assays. The max Tm value for seed target duplex stability was kept at 21.5 °C to reduce off-target effect [29]. Because the GC content of the siRNA duplex is related to its function, a range of 30% to 50% was determined via OligoCalc (http://biotools.nubic.northwestern.edu/OligoCalc.html). In addition, structural and thermodynamic analysis was performed using RNA structure (https://rna.urmc.rochester.edu/RNAstructure.html) to predict secondary structures in terms of their free bending energy at 37 °C. Finally, the effectiveness of siRNA inhibition was evaluated through the siRNApred web server (https://webs.iiitd.edu.in/raghava/sirnapred).

siRNA and pGPU6/GFP/Neo siRNA expression vector were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China) and stored at -20 °C until use. The length of siRNA for each target gene was 21 base pairs. The target sequences were for siRNA-UreB-1352 5'- AAGGTGGGTTCATTGCATTAA-3' and siRNA-CagA-1656 5'- AGGCGGAATTTAGAGGATAAA-3'.

pGPU6/GFP/Neo siRNA expression vector has multiple insertion site for adding selected sequences and also has prokaryotic and eukaryotic markers (antibiotic resistance) and reporters for screening of recombinant host. This vector contains multiple promoters for siRNA expression in multiple hosts and a green fluorescent protein (GFP) expression cassette that can also be coexpressed with siRNAs.

In silico cloning

The pGPU6/GFP/Neo plasmid constructs model were designed using SnapGene software (version 5.2.3) (https://www.snapgene.com/). Each constructs model was in silico analyzed for specific restriction enzyme pattern using SnapGene software.

Natural transformation

Transformations were performed as previously described [30]. H. pylori strain SS1, which had grown for 3–4 days on LB plates with 8% FCS, was suspended in 1 ml of phosphate buffered saline (PBS; pH 7.4) (Fig. 3). When the optical density of the suspension at 550 nm (OD550) reached 0.3, it was centrifuged at 8500 g for 5 min and the pellet was resuspended in 150 μl of PBS. Each transformation mixture, consisting of 46 μl of recipient cells (~ 107 cells) and 4 μl of donor cell plasmid DNA, was spotted onto a non-selective plate and then incubated for 24 h at 37 °C in an Anoxomat jar adjusted to contain the appropriate atmospheric conditions. After overnight incubation, the transformation mixture was harvested from the surface of the plate into 1 ml of PBS. Finally, 50 μl of this suspension were inoculated on LB (non-selective and selective) plates 8% FCS and 10 μg/ml kanamycin and the plates were incubated for 3 days. The transformation efficiency was determined by the number of CFU in selected plates divided by the total CFU in non-selective media. It should be noted that in each transformation experiment, the SS1 strain of H. pylori without added DNA was also tested on the selective medium (10 μg/ml kanamycin) as a negative control. In any case, no clones were seen. Also, at the beginning of each step of this process, we repeated the urease broth test to confirm the SS1 strain of H. pylori.

Fig. 3
figure 3

The stages of natural transformation. The figure is created using BioRender.com

Full size image

Extraction and evaluation of plasmid DNA

The plasmid pattern of the recombinant strain was evaluated for confirming the transformation process. The Plasmid was extracted from fresh cultured strains using FavorPrep™ Plasmid Extraction Mini Kit (Pintung, Taiwan) according to the manufacturer’s instructions. Horizontal electrophoresis system (Bio-Rad USA) was used to visualization of plasmid pattern by agarose gel electrophoresis. In addition, plasmid DNA quality was measured by an ultraviolet spectrophotometer (Nano drop Technologies, Inc., Wilmington, DE, USA) at 260 and 280 nm.

Plasmid DNA sequence analysis and PCR assay

For verification, plasmids were sequenced with T7-F promoter (5′ TAATACGACTCACTATAGGG 3′) and T3-R promoter (5′ ATTAACCCTCACTAAAGGGAA 3′) primers for pGPU6/GFP/Neo constructs. The reaction mixture for polymerase chain reaction (PCR) assay was 25 μL that was prepared as follows: 1X Taq premix Master mix (Ampliqon, Denmark), 0.4 pmol of each forward and reverse primer (Table 1), and 3 μl of purified plasmid DNA sample. The PCR temperature program was performed as follows: an initial denaturation step for 5 min at 95 °C, followed by 34 cycles at 95 °C for 30 s, 52 °C for 45 s, and 72 °C for 1 min, and final extension at 72 °C for 10 min in a Bio-Rad thermal cycler (Bio-Rad Laboratories, Inc., USA). The products PCR were subjected to 2% Agarose gel electrophoresis.

Table 1 qPCR primers for identification of H. pylori ureB, ureC and cagA genes
Full size table

Sequencing

Sequencing was done by Bioneer Co., Korea mediated by Pishgam Co., Iran, and the data was analyzed using BioEdit software version 7.5.2 [31].

Effect of urease inhibition in H. pylori

In order to investigate the inhibitory effect of siRNA on the urease activity of H. pylori recombinant strain, the activity of this enzyme was evaluated by urea broth medium (Difco, Detroit, MI, USA), compared to the non-recombinant strain. Urea broth medium was prepared as follows: 10 g of urea, 0.05 of yeast extract, 4.5 g of potassium phosphate, monobasic, 4.7 g of potassium phosphate, dibasic and 0.005 g of Phenol red. All ingredients were dissolved in 500 ml of distilled water and after filtering (pore size 0.45 mm). Then the pH was adjusted to 6.8 and 1 ml of the solution, added to the sterilized 1.5 ml microtubes and stored at 4 °C. A concentration of 1 McFarland was prepared from recombinant and non-recombinant SS1 strains of H. pylori and 100 μl of each strain was added to the urea broth medium and the result was read after incubation.

RNA extraction and qPCR

Total RNA extraction was performed using the FavorPrep™ RNA extraction kit (Pintung, Taiwan) according to the manufacturer's instructions. Briefly, after overnight cultivation of H. pylori SS1 recombinant strain, which was in microaerophilic conditions, a suspension was prepared and 200 μL of lysing buffer was added to it and incubated for 10 min at room temperature. Then 1 ml of YTzol was added to the suspension and centrifuged at 12,000 rpm for 3 min. By adding and repeatedly centrifuging the material, finally, the purified RNA was stored at -20 °C. The purity of the RNA preparations was also analyzed using an ultraviolet spectrophotometer (Nano drop Technologies, Inc., Wilmington, DE, USA). cDNA synthesis was performed with FavorPrep™ RNA extraction kit (Pintung, Taiwan) according to the manufacturer's instructions.

For quantitative PCR (qPCR) Each reaction mixture consisted of 5 μl of cDNA, 1 μl each of forward and reverse primers, 5 μl of nuclease-free water and 13 μl of SYBR Green PCR Master Mix in a total reaction volume of 25 μl (96-well optical plates). The thermal cycler program consisted of a preliminary step of 10 min at 95 °C; 45 cycles of 15 s at 95 °C; and 1 min at 60 °C using SYBR Green Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR assay was performed in duplicate and the presented results are the average of these assays and are expressed in copies per milliliter. The sequences of primers in this study were designed by Oligo 7 software (Molecular Biology Insights, Inc., Cascade, CO, USA) and OligoAnalyzer online server (https://www.idtdna.com/pages/tools/oligoanalyzer) and synthesized by Invitrogen (Shanghai, China). Also, primers were aligned by multiple sequence alignment (MSA) method using Clustal Omega software (https://www.ebi.ac.uk/Tools/msa/clustalo/). The sequence of gene expression primers is shown in Table 1.

Statistical analysis

REST (Relative Expression Software Tool) software was used for statistical analysis of relative expression results in real-time PCR [32]. The obtained results were analyzed using paired t-test and P < 0.05 was considered significant.

Results

Transformation of H. pylori SS1 strain

The number of colonies of transformed bacteria on LB agar medium was uncountable, which indicates the high efficiency of the natural transformation method. Plasmid profiling of several suspected colonies proved that the colonies contained pGPU6/GFP/Neo plasmid. PCR confirmed the presence of pGPU6/GFP/Neo plasmid as well as ureB and cagA genes (Fig. 4B).

Fig. 4
figure 4

A In silico simulation for pGPU6/GFP/Neo plasmid constructs model using SnapGene software; Lane 1: 1 Kb DNA ladder; Lanes 2 and 3: 426 bp in silico digested product for the recombinant strain containing siRNA-ureB and siRNA-cagA using the in silico method. B Confirming the presence of the transformed pGPU6/GFP/Neo plasmid along with the inserted fragments; Lane 1: 1 Kb DNA ladder; Lanes 2, 4, 5 and 6: 426 bp product for the recombinant strain containing siRNA-UreB and siRNA-CagA; Lane 3: negative control

Full size image

Sequence selection and evaluation of candidate siRNAs

Different siRNAs were obtained in the siDirect 2.0 web server, and finally siRNA-UreB-1352 5'- AAGGTGGGTTCATTGCATTAA-3' and siRNA-CagA-1656 5'- AGGCGGAATTTAGAGGATAAA-3' were selected for synthesis. It was found that the GC content for both siRNAs was 38%. Our findings showed that the binding energy for siRNA-UreB and siRNA-CagA was -28 and -25.2, respectively, with an inhibition efficiency of about 0.9, which allowed us to predict usefulness for in vitro evaluation.

In silico cloning

BamHI (GGATCC) and Bbs I (GAAGAC) restriction sites were added to the upstream and downstream of the pGPU6/GFP/Neo plasmid constructs model sequence. Finally, we used SnapGene software to integrate the adapted DNA sequence to the pGPU6/GFP/Neo vector, between the BamHI and Bbs I restriction sites (Fig. 5). In silico digestion and gel electrophoresis simulation confirmed the desired final products, shown in Fig. 4A.

Fig. 5
figure 5

In silico cloning of the pGPU6/GFP/Neo expression vector designed using SnapGene software (version 5.2.3) (https://www.snapgene.com/)

Full size image

In vitro effects of urease inhibition

In this study, we investigated the urease inhibitory effect using urea broth medium (pH 6.8). The native strain of H. pylori SS1 was used as a positive control along with the recombinant strain by siRNA-UreB. Our results showed that siRNA-UreB could successfully prevent the urease enzyme activity of this bacterium in urea broth environment (Fig. 6).

Fig. 6
figure 6

Inhibitory effect of urease activity

Full size image

ureB and cagA genes expression in H. pylori SS1 strain after siRNA transfection

We determined the expression level of ureB and cagA genes in H. pylori strain SS1 with and without siRNA transfection by real-time PCR method. The 2−ΔΔCt method was used to determine the difference in normalized ureB and cagA gene expression caused by different siRNAs. Our results showed that siRNA-ureB and siRNA-cagA can significantly reduce level of gene expression in comparison with non-siRNA (P < 0.05). Meanwhile, the expression levels of siRNA-UreB and siRNA-CagA in the recombinant strain SS1 were reduced by about 5000 and 1000 fold, respectively, compared to the native H. pylori strain SS1 (Fig. 7).

Fig. 7
figure 7

Box plots of qPCR data. A Boxplot of the expression level of siRNA-UreB in the recombinant strain SS1 decreased by about 5000 fold compared to the native strain of H. pylori SS1. B Boxplot of the expression level of siRNA-CagA in the recombinant strain SS1 decreased by about 1000 fold compared to the native strain of H. pylori SS1

Full size image

Discussion

H. pylori is strongly interested in unique colonization in the deep mucosal layer of the stomach. Several mechanisms including motility, urease production, adhesion, and CagA are important in H. pylori colonization [2]. This pathogen uses its urease activity to neutralize the acidic conditions of the host's stomach. Specific interactions between bacterial adhesins and host cell receptors lead to successful colonization and persistent infection. Finally, the bacterium releases several virulence factors (such as CagA, urease, VacA) that cause host tissue damages [9]. In this regard, several studies have been conducted to reduce colonization by inhibiting virulence factors.

H. pylori is a natural competence along with, N. gonorrhoeae, S. pneumoniae and B. subtilis. In this bacterium, natural competence is associated with proteins in the comB locus, a feature that is not found in other bacteria with natural competence [30, 33, 34]. A pGPU6/GFP/Neo siRNA construct containing siRNA inhibiting ureB or cagA was designed and synthesized. We used the natural competence method to transform the constructs into H. pylori SS1 strain in order to inhibit ureB or cagA pathogenicity factors, and their inhibition effect were analyzed phenotypic and genotypically.

Urease is a virulence factor associated with pathogenicity in various pathogenic bacteria, that is essential in the colonization and maintenance of bacterial cells in host tissues [35, 36]. In several studies, the inhibition of H. pylori urease enzyme by chemical compounds has been shown. Unfortunately, the investigations that has been done so far could not provide the desired effects to inhibit this enzyme, which include hydrolytic instability, toxicity, and adverse side effects [37]. One of these compounds is fluorofamide (N-(diaminophosphinyl)-4-fluorobenzenamide), which cannot inhibit urease due to its instability in acidic conditions [38]. In two studies possible in vitro and in vivo inhibitory effect of Palmatine (Pal) from Coptis chinensis on urease were evaluated. The results showed that Pal, which targets sulfhydryl groups, emerged as a promising candidate as a urease inhibitor [12, 39]. In addition, Macegoniuk et al. used a group of urease inhibitors, namely aminophosphinic acid and aminophosphonic acid derivatives, against H. pylori urease in laboratory conditions. The results of this study showed that bis (N-methylaminomethyl) phosphinic acid acted as the most effective inhibitor in the sensitivity profile studies of H. pylori J99 [40]. Another compound that has been evaluated to inhibit urease enzyme activity is Acetohydroxamic acid (AHA). AHA is structurally similar to urea and has an effective activity in inhibiting the bacterial urease enzyme, but some limitations related to severe side effects, such as psycho-neural and muscular-other symptoms, have led to the limited use of this treatment [41, 42].

So far, no study has been conducted to inhibit the urease enzyme activity from H. pylori using siRNA. In this study, we evaluated the effect of siRNA to inhibit urease enzyme activity using two phenotypic and genotypic methods in H. pylori SS1 strain for the first time. After examining the basic characteristics of siRNA and confirming the inhibitory effect of this molecule, we can conclude that in the future siRNA-UreB can have a potential effect in helping the treatment.

CagA is able to activate NF-κB and translocate it to the nucleus, where it regulates the transcription of IL-8, a chemotactic and inflammatory cytokine. To further confirm the role of NF-κB, Yang et al. transfected NF-κB-specific siRNA into gastric cancer cells and succeeded in downregulating NF-κB expression [43]. Also, studies showed that the use of siRNA against CagA mRNA as an inhibitor led to a decrease in IL-8 production at different times (6, 12 and 24 h after electroporation) [44]. In the other hand, CagA negatively regulates autophagy and promotes inflammation in H. pylori infection, which is regulated by the activation of the c-Met-PI3K/Akt-mTOR signaling pathway. Li et al. showed that c-Met siRNA significantly affected CagA-mediated autophagy and decreased the levels of p-Akt, p-mTOR, and p-S6 [45]. Signal transducer and activator of transcription 3 (STAT3) is a transcription factor encoded by the STAT3 gene in humans. To investigate the role of STAT3 in mediating CagA-dependent regenerating islet-derived protein 3 gamma (REG3γ) transcription, a STAT3-specific siRNA was used. The results showed that transfection of a STAT3-specific siRNA led to almost complete depletion of the total STAT3 protein [46]. In addition, Barry and colleagues investigated the effect of a new inhibitor, D,l-a-difluoromethylornithine (DFMO), in H. pylori-infected mice. The findings of their study showed that DFMO inhibited the expression level of H. pylori cagA gene and its phosphorylation in gastric epithelial cells, which was associated with the reduction of interleukin-8 expression [47]. We used the pGPU6/GFP/Neo plasmid to transfer the cagA gene, and finally the qPCR results showed a decrease in the expression level of this gene up to 1000 fold. These findings indicated that siRNA-CagA may contribute to the effectiveness of reducing gastritis and colonization.

In general, based on the results of this study, it was found that siRNA can have a potential effect in reducing or inhibiting the activity of ureB and cagA and reducing the pathogenicity of H. pylori and act as a promising perspective to suppress other pathogenic factors of this pathogen.

Conclusion

It conclusion siRNA-ureB and siRNA-cagA were reduced the expression level of UreB and CagA, and as a result, H. pylori colonization and inflammation in the gastric mucosa were decreased. Finally, the results of this study showed that siRNA can be promising for the treatment of H. pylori infection, but more in vivo studies are needed regarding the effectiveness of siRNA on diseases associated with this pathogen.

Limitations

The main limitations of this study is the lack of an animal model to investigate pGPU6/GFP/Neo plasmid recombinant clinical isolates.

Availability of data and materials

All the data supporting the findings are contained within the manuscript.

References

  1. Wu X, Zhao Y, Zhang H, Yang W, Yang J, Sun L, et al. Mechanism of regulation of the Helicobacter pylori Cagβ ATPase by CagZ. Nat Commun. 2023;14(1):479.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  2. Malfertheiner P, Camargo MC, El-Omar E, Liou J-M, Peek R, Schulz C, et al. Helicobacter pylori infection. Nat Rev Dis Primers. 2023;9(1):19.

    Article  PubMed  Google Scholar 

  3. Polk DB, Peek RM Jr. Helicobacter pylori: gastric cancer and beyond. Nat Rev Cancer. 2010;10(6):403–14.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  4. Plummer M, de Martel C, Vignat J, Ferlay J, Bray F, Franceschi S. Global burden of cancers attributable to infections in 2012: a synthetic analysis. Lancet Glob Health. 2016;4(9):e609–16.

    Article  PubMed  Google Scholar 

  5. Ha N-C, Oh S-T, Sung JY, Cha KA, Lee MH, Oh B-H. Supramolecular assembly and acid resistance of Helicobacter pylori urease. Nat Struct Biol. 2001;8(6):505–9.

    Article  PubMed  CAS  Google Scholar 

  6. Logan RP, Walker MM. ABC of the upper gastrointestinal tract: Epidemiology and diagnosis of Helicobacter pylori infection. BMJ. 2001;323(7318):920.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  7. Fonseca TL, Moraes EP, Juliano CR, Silva AM, Scaini CJ, Mendoza-Sassi RA, et al. Detection of Helicobacter pylori by phenotypic and genotypic methods. Dig Dis Sci. 2010;55:1643–8.

    Article  PubMed  Google Scholar 

  8. Chang W-L, Yeh Y-C, Sheu B-S. The impacts of H. pylori virulence factors on the development of gastroduodenal diseases. J Biomed Sci. 2018;25(1):1–9.

    Article  CAS  Google Scholar 

  9. Kao C-Y, Sheu B-S, Wu J-J. Helicobacter pylori infection: An overview of bacterial virulence factors and pathogenesis. Biomedical Journal. 2016;39(1):14–23.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Blaser MJ. Epidemiology and pathophysiology of Campylobacter pylori infections. Reviews of Infectious Diseases. 1990;12 Suppl 1:S99–106. Epub 1990/01/01. https://0-doi-org.brum.beds.ac.uk/10.1093/clinids/12.supplement_1.s99. PubMed PMID: 2406864.

  11. Lucas B, Bumann D, Walduck A, Koesling J, Develioglu L, Meyer TF, et al. Adoptive transfer of CD4+ T cells specific for subunit A of Helicobacter pylori urease reduces H. pylori stomach colonization in mice in the absence of interleukin-4 (IL-4)/IL-13 receptor signaling. Infection and Immunity. 2001;69(3):1714–21. Epub 2001/02/17. https://0-doi-org.brum.beds.ac.uk/10.1128/iai.69.3.1714-1721.2001. PubMed PMID: 11179348; PubMed Central PMCID: PMCPMC98077.

  12. Zhou J-T, Li C-L, Tan L-H, Xu Y-F, Liu Y-H, Mo Z-Z, et al. Inhibition of Helicobacter pylori and its associated urease by palmatine: investigation on the potential mechanism. PLoS ONE. 2017;12(1):e0168944.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Rego YF, Queiroz MP, Brito TO, Carvalho PG, de Queiroz VT, de Fátima Â, et al. A review on the development of urease inhibitors as antimicrobial agents against pathogenic bacteria. J Adv Res. 2018;13:69–100.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  14. Zhang H, Liu M, Li Y, Zhao Y, He H, Yang G, et al. Oral immunogenicity and protective efficacy in mice of a carrot-derived vaccine candidate expressing UreB subunit against Helicobacter pylori. Protein Expr Purif. 2010;69(2):127–31.

    Article  PubMed  CAS  Google Scholar 

  15. Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, et al. cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc Natl Acad Sci. 1996;93(25):14648–53.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  16. Selbach M, Moese S, Hurwitz R, Hauck CR, Meyer TF, Backert S. The Helicobacter pylori CagA protein induces cortactin dephosphorylation and actin rearrangement by c-Src inactivation. EMBO J. 2003;22(3):515–28.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  17. Ansari S, Yamaoka Y. Helicobacter pylori Infection, Its Laboratory Diagnosis, and Antimicrobial Resistance: a Perspective of Clinical Relevance. Clinical Microbiology Reviews. 2022;35(3):e0025821. Epub 2022/04/12. https://0-doi-org.brum.beds.ac.uk/10.1128/cmr.00258-21. PubMed PMID: 35404105; PubMed Central PMCID: PMCPMC9491184.

  18. Abdullah M, Greenfield LK, Bronte-Tinkew D, Capurro MI, Rizzuti D, Jones NL. VacA promotes CagA accumulation in gastric epithelial cells during Helicobacter pylori infection. Sci Rep. 2019;9(1):38.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Foegeding NJ, Caston RR, McClain MS, Ohi MD, Cover TL. An overview of Helicobacter pylori VacA toxin biology. Toxins. 2016;8(6):173.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Hatakeyama M. Helicobacter pylori CagA and gastric cancer: a paradigm for hit-and-run carcinogenesis. Cell Host Microbe. 2014;15(3):306–16.

    Article  PubMed  CAS  Google Scholar 

  21. Schöttker B, Adamu MA, Weck MN, Brenner H. Helicobacter pylori infection is strongly associated with gastric and duodenal ulcers in a large prospective study. Clin Gastroenterol Hepatol. 2012;10(5):487-93.e1.

    Article  PubMed  Google Scholar 

  22. Kikuchi K, Murata-Kamiya N, Kondo S, Hatakeyama M. Helicobacter pylori stimulates epithelial cell migration via CagA-mediated perturbation of host cell signaling. Microbes Infect. 2012;14(5):470–6.

    Article  PubMed  CAS  Google Scholar 

  23. Boonyanugomol W, Chomvarin C, Baik S-C, Song J-Y, Hahnvajanawong C, Kim K-M, et al. Role of cag A-positive Helicobacter pylori on cell proliferation, apoptosis, and inflammation in biliary cells. Dig Dis Sci. 2011;56:1682–92.

    Article  PubMed  Google Scholar 

  24. Sharma SA, Tummuru MK, Miller GG, Blaser MJ. Interleukin-8 response of gastric epithelial cell lines to Helicobacter pylori stimulation in vitro. Infection and Immunity. 1995;63(5):1681–87. Epub 1995/05/01. https://0-doi-org.brum.beds.ac.uk/10.1128/iai.63.5.1681-1687.1995. PubMed PMID: 7729872; PubMed Central PMCID: PMCPMC173210.

  25. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 1998;391(6669):806–11.

    Article  PubMed  CAS  Google Scholar 

  26. Lares MR, Rossi JJ, Ouellet DL. RNAi and small interfering RNAs in human disease therapeutic applications. Trends Biotechnol. 2010;28(11):570–9.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  27. Yanagihara K, Tashiro M, Fukuda Y, Ohno H, Higashiyama Y, Miyazaki Y, et al. Effects of short interfering RNA against methicillin-resistant Staphylococcus aureus coagulase in vitro and in vivo. J Antimicrob Chemother. 2006;57(1):122–6.

    Article  PubMed  CAS  Google Scholar 

  28. Friedrich M, Aigner A. Therapeutic siRNA: state-of-the-art and future perspectives. BioDrugs. 2022;36(5):549–71.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  29. Naito Y, Yoshimura J, Morishita S, Ui-Tei K. siDirect 2.0: updated software for designing functional siRNA with reduced seed-dependent off-target effect. BMC Bioinformatics. 2009;10(1):1–8.

  30. Lin EA, Zhang X-S, Levine SM, Gill SR, Falush D, Blaser MJ. Natural transformation of Helicobacter pylori involves the integration of short DNA fragments interrupted by gaps of variable size. PLoS Pathog. 2009;5(3): e1000337.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Hall T, Biosciences I, Carlsbad C. BioEdit: an important software for molecular biology. GERF Bull Biosci. 2011;2(1):60–1.

    Google Scholar 

  32. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30(9):e36-e.

  33. Levine SM, Lin EA, Emara W, Kang J, DiBenedetto M, Ando T, et al. Plastic cells and populations: DNA substrate characteristics in Helicobacter pylori transformation define a flexible but conservative system for genomic variation. FASEB J. 2007;21(13):3458–67.

    Article  PubMed  CAS  Google Scholar 

  34. Israel DA, Lou AS, Blaser MJ. Characteristics of Helicobacter pylori natural transformation. FEMS Microbiol Lett. 2000;186(2):275–80.

    Article  PubMed  CAS  Google Scholar 

  35. Konieczna I, Zarnowiec P, Kwinkowski M, Kolesinska B, Fraczyk J, Kaminski Z, et al. Bacterial urease and its role in long-lasting human diseases. Curr Protein Pept Sci. 2012;13(8):789–806.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  36. Follmer C. Ureases as a target for the treatment of gastric and urinary infections. J Clin Pathol. 2010;63(5):424–30.

    Article  PubMed  CAS  Google Scholar 

  37. Modolo LV, de Souza AX, Horta LP, Araujo DP, de Fátima Â. An overview on the potential of natural products as ureases inhibitors: A review. J Adv Res. 2015;6(1):35–44.

    Article  PubMed  CAS  Google Scholar 

  38. Pope AJ, Toseland N, Rushant B, Richardson S, Mcvey M, Hills J. Effect of potent urease inhibitor, fluorofamide, on Helicobacter sp. in vivo and in vitro. Digest Dis Sci. 1998;43:109–19.

    Article  PubMed  CAS  Google Scholar 

  39. Jung J, Choi JS, Jeong C-S. Inhibitory activities of palmatine from coptis chinensis against helicobactor pylori and gastric damage. Toxicol Res. 2014;30:45–8.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  40. Macegoniuk K, Grela E, Biernat M, Psurski M, Gościniak G, Dziełak A, et al. Aminophosphinates against Helicobacter pylori ureolysis—Biochemical and whole-cell inhibition characteristics. PLoS ONE. 2017;12(8): e0182437.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Jain SK, Haider T, Kumar A, Jain A. Lectin-conjugated clarithromycin and acetohydroxamic acid-loaded PLGA nanoparticles: A novel approach for effective treatment of H. pylori. AAPS PharmSciTech. 2016;17:1131–40.

  42. Hassan ST, Šudomová M. The development of urease inhibitors: what opportunities exist for better treatment of Helicobacter pylori infection in children? Children. 2017;4(1):2.

    Article  PubMed  PubMed Central  Google Scholar 

  43. Yang F, Xu Y, Liu C, Ma C, Zou S, Xu X, et al. NF-κB/miR-223-3p/ARID1A axis is involved in Helicobacter pylori CagA-induced gastric carcinogenesis and progression. Cell Death Dis. 2018;9(1):12.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Yan Y, Zhan W, Zhao G, Ma J, Cai S. Use of SiRNA to investigate the role of CagA on H. pylori induced IL-8 production from gastric epithelial cells. Hepato Gastroenterol. 2007;54(78):1868–73.

    CAS  Google Scholar 

  45. Li N, Tang B, Jia Y-p, Zhu P, Zhuang Y, Fang Y, et al. Helicobacter pylori CagA protein negatively regulates autophagy and promotes inflammatory response via c-Met-PI3K/Akt-mTOR signaling pathway. Front Cell Infect Microbiol. 2017;7:417.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Lee KS, Kalantzis A, Jackson CB, O’Connor L, Murata-Kamiya N, Hatakeyama M, et al. Helicobacter pylori CagA triggers expression of the bactericidal lectin REG3γ via gastric STAT3 activation. PLoS ONE. 2012;7(2):e30786.

  47. Barry DP, Asim M, Leiman DA, de Sablet T, Singh K, Casero RA Jr, et al. Difluoromethylornithine is a novel inhibitor of Helicobacter pylori growth, CagA translocation, and interleukin-8 induction. PLoS ONE. 2011;6(2):e17510.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This study was financially supported by Kermanshah University of Medical Sciences (grant number 4010412).

Author information

Authors and Affiliations

  1. Department of Microbiology, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Hamid Motamedi

  2. Student Research Committee, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Hamid Motamedi

  3. Fertility and Infertility Research Center, Health Technology Institute, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Ramin Abiri

  4. Department of Immunology, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Farhad Salari

  5. Medical Biology Research Center, Health Technology Institute, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Cyrus Jalili

  6. Medical Technology Research Center, Health Technology Institute, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Amirhoushang Alvandi

Authors
  1. Hamid Motamedi
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Ramin Abiri
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Farhad Salari
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Cyrus Jalili
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Amirhoushang Alvandi
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Experimental Implementation: H.M., R.A. and A.A.; Resources: C.J., F.S. and A.A.; Writing—Original Draft Preparation: H.M., F.S. and A.A.; Writing—Review and Editing: H.M., A.A., R.A., F.S., and C.J.; Supervision: H.M., R.A. and A.A.

Corresponding author

Correspondence to Amirhoushang Alvandi.

Ethics declarations

Ethics approval and consent to participate

This study was carried out with the Code of Ethics Committee (Ref. ID: IR. KUMS. AEC.1401.022) adopted by Kermanshah University of Medical Sciences.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Motamedi, H., Abiri, R., Salari, F. et al. Reduction of UreB and CagA expression level by siRNA construct in Helicobacter pylori strain SS1. BMC Microbiol 23, 401 (2023). https://0-doi-org.brum.beds.ac.uk/10.1186/s12866-023-03143-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12866-023-03143-x

Keywords

BMC Microbiology

ISSN: 1471-2180

Contact us