Skip to main content
Download PDF

Detection of virulence genes of Staphylococcus aureus isolated from raw beef for retail sale in the markets of Ulaanbaatar city, Mongolia

BMC Microbiology volume 23, Article number: 372 (2023) Cite this article

Abstract

Background

Staphylococcus aureus (S. aureus) is a highly virulent pathogen that causes food-borne illness, food poisoning, skin and soft tissue infections, abscesses, mastitis, and bacteremia. It is common for meat and meat products to become contaminated with S. aureus due to dirty hands, food storage conditions, food production processes, and unhygienic conditions, causing food poisoning. Therefore, we aimed to isolate S. aureus strain from the raw beef and reveal virulence genes and antibiotic resistance profile from isolated S. aureus strains.

Methods

In this study, 100 samples of raw beef were collected from 4 major market stalls in Ulaanbaatar city, Mongolia. S. aureus was detected according to the ISO 6888–1:2021 standard, and the nucA gene encoding the species-specific thermonuclease was amplified and confirmed by polymerase chain reaction (PCR). In the strains of S. aureus isolated from the samples, the genes encoding the virulence factors including sea, sed, tsst, eta, etb, and mecA were amplified by multiplex PCR. These genes are encoded staphylococcal enterotoxin A, enterotoxin D, toxic shock syndrome toxin, exotoxin A, exotoxin B and penicillin-binding protein PBP 2A, respectively. Antibiotic sensitivity test was performed by the Kirby–Bauer disc diffusion method. The Clinical and Laboratory Standard Institute guidelines as CLSI M100-S27 was used for analysis of the data.

Results

Thirty-five percent of our samples were detected contaminated with of the S. aureus strains. Subsequently, antibiotic resistance was observed in the S. aureus contaminated samples. Among our samples, the highest rates of resistance were determined against ampicillin (97.1%), oxacillin (88.6%), and penicillin (88.6%), respectively. Three genes including mecA, sea, and tsst from six virulence genes were detected in 17% of S. aureus strain-contaminated samples by multiplex PCR. The sed, etb and eta genes were detected in the 2.9%, 11.4% and 5.7% of our samples, respectively.

Conclusion

The results show that S. aureus related contamination is high in the raw beef for retail sale and prevalent S. aureus strains are resistant to all antibiotics used. Also, our results have demonstrated that there is a high risk for food poisoning caused by antibiotic resistant S. aureus in the raw beef and it may establish public health issues. Genes encoding for both heat-resistant and nonresistant toxicity factors were detected in the antibiotic resistant S. aureus strains and shown the highly pathogenic. Finally, our study is ensuring to need proper hygienic conditions during beef’s preparation and sale.

Peer Review reports

Introduction

Staphylococcus aureus (S. aureus) is a highly virulent bacterial pathogen that causes food-borne diseases, food poisoning, skin and soft tissue infections, pneumonia, mastitis, and bacteremia [1, 2].

S. aureus presents abundantly in large quantities on skin and mucous membranes of humans and animals, and it is transmitted directly or indirectly from an infected person [3]. Raw and semiprocessed food products, such as meat, meat products, eggs, milk, and dairy products, are often contaminated with S. aureus due to dirty hands, food storage conditions, food production, and unhygienic conditions [4, 5]

In recent years, many studies on the distribution of S. aureus have been conducted around the world, but in our country, there are few studies on the distribution of S. aureus in food products. Shi Wu and Jiahu Huang et al. have reported that 35% of the samples collected 39 cities from 2011 to 2016 in China was positive for S. aureus, and 51% of the highly contaminated samples were raw meat [6]. According to a 2017 study by Tang, 27.9% of raw meat samples for retail sale in the United States and 68% in Denmark were contaminated with S. aureus [7]. Mongolia ranks 10th in the world in per capita meat consumption, with 108.8 kg of meat consumed per person per year, which is 2.7 times higher than the average world consumption. According to the data released by the National Statistics Committee of Mongolia, 69.3% of meat products are consumed including 2.3% of pork products, 0.4% of poultry, 15% of sausages and canned meat, and 13% of seafood [8].

Staphylococcal food poisoning is a common food-borne illness caused by S. aureus enterotoxin contamination. Because S. aureus contains a wide range of toxic factors, food poisoning and foodborne infections caused by staphylococcus are a major public health problem [9]. In particular, staphylococcal enterotoxin, toxic shock syndrome toxin, and exotoxin are resistant to high temperatures and acidic environments, so they cause food poisoning without being broken down by digestive enzymes [10]. Strains containing heat-resistant virulence factors can also contaminate ready-to-eat food and infect humans when hygienic safety is lost [11].

The imprudent and indiscriminate usage of antibiotics in public and veterinary clinical practices has led to the development of multiple drug-resistant (MDR) pathogens. Commonly practiced antibiotics for treatment i.e. beta-lactams, macrolides, lincosamides, streptogramins, and fluoroquinolones are facing resistance due to their undue and persistent usage in animals. The number of effective antibiotics against MDR pathogens is rapidly declining and the advent of new antibiotics in clinical practice requires a prolonged time and has monetary challenges as well [12].

As S. aureus has developed and adapted its resistance mechanism to antibiotics, for instance, the strains resistant not only to penicillin and methicillin but also to the linezolid and daptomycin [13,14,15].

One public health concern is that antibiotic resistance in bacteria continues to increase worldwide. The imprudent and indiscriminate usage of antibiotics in public and veterinary clinical practices has led to the development of MDR pathogens. For instance beta-lactam antibiotics are commonly used in the treatment of staphylococcal infections, but the number of strains of S. aureus that secrete beta-lactamase and are resistant to lactam antibiotics is increasing [16]. In 1960, methicillin, a new antibiotic in the penicillin group, was discovered and used effectively in the treatment of S. aureus infections, but the incorporation of outside DNA encoding the mecA gene led to methicillin resistance, and thus the therapeutic effect of all beta-lactam antibiotics decreased [17]. In the Netherlands and Canada, 20–40% of all S. aureus strains detected in pork were identified as methicillin-resistant S. aureus (MRSA) [18]. S. aureus has human and swine isolates that were resistant to penicillin, oxacillin, and tetracycline, and susceptible to trimethoprim-sulfamethoxazole, gentamicin, levofloxacin, moxifloxacin, linezolid, daptomycin, vancomycin and rifampin [19].

In our country, there is a high risk of food poisoning caused by S. aureus due to high consumption of meat, uncontrolled use of antibiotics for livestock, and insufficient hygienic environment for retail sales. This study was designed to detect S. aureus contamination in retail meat, and prevent from S. aureus-related food poisoning and provide appropriate treatment by detecting the virulence and antibiotic resistance of the pathogen. Hence, it would be a basic research to improve the hygienic environment in which meat prepared and sold, and provide warning information that the meat should be fully processed and consumed for customers.

Materials and methods

This study was conducted using a cross-sectional design. Raw beefs are sold at retail in 4 major marketplaces, which located differently in Ulaanbaatar city. Then, 100 samples of raw beef were collected from the above-mentioned marketplaces from June to December 2021, and delivered within two hours to the microbiological laboratory of the Department of Molecular Biology and Genetics, Mongolian National University of Medical Sciences.

Isolation of S.aureus from the samples

To detect the S. aureus from collected samples, 25 g meat samples were placed in 225 ml of peptone broth, and 1 ml of the homogenized solution was diluted by a factor of 103 according to ISO 6888–1:2021. One milliliter of the diluted solution was taken and distributed evenly in a Baird-Parker (BP) selective medium environment (Biolab, Hungary). The plates were incubated at 37°C for 24 hours. After incubation, black colonies with a clear border were evaluated as suspected S. aureus. Up to five colonies were chosen, and PCR assay was applied for the identification of S. aures [3].

Identification of S. aureus using PCR assay

DNA was extracted by preparing a bacterial suspension from the culture, boiling it at 100°C for 10 min, followed by sedimentation in a centrifuge for 10 min at 12000 rpm [20]. Then, DNA was checked by nanodrop spectrophotometer (Thermo fisher Scientific. LLC) for yield and purification, and used for further analysis.

The 270 kb product of the nucA gene encoding a species-specific thermonuclease of S. aureus was amplified and confirmed by PCR. A total of 0.5 μl (100 pmol/μl) of each primer (nuc-F 5′-3'GCGATTGATGGTGATACGGTT), (nuc-R 5′-3′AGCCAAGCCTTGACGAACTAAAGC), and 2 μl of DNA were prepared in the PCR master mix (Bioneer, Korea), and a total of 25 μl of solution was reacted at 95 °C for 10 min, followed by 37 cycles of 94 °C for 1 min, 55 °C for 30 s, 72 °C for 1.5 min, and 72 °C for 10 min. The amplified PCR products were detected by running a 1.5% agarose gel at 100 V for 30 min and staining with ethidium bromide for 20 min [3, 20].

Detection of S. aureus virulence genes by multiplex PCR

S. aureus enterotoxin (sea, sed), toxic shock syndrome toxin (tsst), exotoxin (eta, etb) and penicillin-binding protein (PBP 2A) and its coding gene mecA were amplified in 2 sets by multiplex PCR using the primers in Table 1 [21].

Table 1 Primers for the amplification of staphylococcal genes
Full size table

The PCR steps were as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 2 min, annealing at 55 °C for 2 min, extension at 72 °C for 2 min, followed by a final 7 min extension at 72 °C. The amplified PCR products were detected by running a 1.5% agarose gel at 100 V for 30 min and staining with ethidium bromide for 20 min [3, 21].

Antibiotic susceptibility testing

The disk diffusion method was used to determine the antibiotic susceptibility of the isolates on Muller Hinton agar (Difco, Franklin Lakes, NJ, USA). Each isolate was tested for antibiotic susceptibility using a panel of the following antibiotics: ampicillin (10 μg), oxacillin (30 μg), gentamicin (10 μg), tetracycline (30 μg), chloramphenicol (50 μg), penicillin (10 μg), clindamycin (2 μg), azithromycin (15 μg) and ciprofloxacin (5 μg) (Biolab, Budapest, Hungary). The plates were incubated at 37 °C for 24 h, and the inhibitory zone diameters were measured. Observed result was compared with the criteria recommended by the Clinical and Laboratory Standards Institute guidelines (CLSI M100-S27) and interpretated. Standard S. aureus strain ATCC 25923 was used for validation of antibiotic discs.

Statistical analysis

Statistical analysis of the results in this research work were calculated using SPSS 25. Statistical analysis was performed by using Fisher’s exact test, chi-square test. The level of significance was set at a p value of < 0.05.

Results

Detection of S. aureus contamination in the samples

In this study, the contamination of S. aureus strains were detected in 35% from total samples and validated by expression of gene nucA (Fig. 1).

Fig. 1
figure 1

nucA gene identification. Note: Sm-size marker (100 bp), pos-positive control, and neg-negative control: nuclease free distilled water. Samples 4, 6, and 7 showed amplification of nucA gene product at 270 bp. nucA gene product wasn’t amplified in samples of 1, 2, 3, 5 and 8

Full size image

Determination of the antibiotic resistance of the S. aureus strains

Figure 2 has shown that the highest resistance to ampicillin 97.1% (34/35), oxacillin 88.6% (31/35), and penicillin 88.6% (31/35) observed in the S. aureus strains. In contrast, the resistance to chloramphenicol 8.6% (3/35) was the lowest.

Fig. 2
figure 2

Antibiotic resistance of S. aureus detected in samples. Abbreviations: AM-ampicillin, OX-oxacillin, CN-gentamicin, TE-tetracycline, C30 chloramphenicol, P-penicillin, DA-clindamycin, AZM-azithromycin, CIP-ciprofloxacin

Full size image

Forty percent (14/35) of S. aureus isolated from the samples were determined as resistant to more than 3 groups of antibiotics, indicating that the strains are multidrug-resistant (MDR). In our study, 3 and 4 groups of antibiotic-resistant S. aureus strains was identified in 11 samples, as well as 5 groups of antibiotic-resistant strains were identified in 2 samples, respectively. One strain was resistant to all 9 antibiotics of the 7 groups tested.

Detection of virulence factor genes in S. aureus strains

Six virulence genes were detected by multiplex PCR in the S. aureus strains isolated from meat. As shown in Fig. 3, number of three genes including encoding penicillin-binding protein (PBP 2A) (mecA), enterotoxin A (sea), and toxic shock syndrome toxin (tsst) were observed in 17.1% (6/35) of the contaminated samples. Moreover, exotoxin type A (eta) and exotoxin type B (etb) were found in 5.7% (2/35) and 11.4% (4/35), as well as enterotoxin D (sed) in 2.9% (1/35) among contaminated samples.

Fig. 3
figure 3

Detection of virulence genes

Full size image

Table 2 shows the overlap of the virulence genes in the S. aureus strains.

Table 2 Detection of overlapping virulence genes in S. aureus
Full size table

Four genes such as mecA, eta, etb, sea were similarly identified in 14.3% (5/35) of the S. aureus strains, but only one gene was identified in 34.3% (12/35) of those samples. The presence of virulence genes was evaluated in both antibiotic-resistant and antibiotic-sensitive groups (Table 3). No statistically significant differences were observed when evaluating the expression of virulence genes in the antibiotic-resistant and antibiotic- susceptibility groups (p > 0.05).

Table 3 Detection of virulence genes among the antibiotic-resistant S. aureus strains
Full size table

Discussion

Meat and meat products are widely consumed in all countries and are rich in fat, protein, and many vitamins. In the last 50 years, following the doubling of the world's population, the consumption of meat products used in food has tripled [22].

In our country, the number of animals has reached more than 60 million, and animal products, especially meat, are used for food. We are ranked 10th in the world in terms of meat consumption, with 2.7 times more meat consumed than the world average [8].

The prevalence of S. aureus contamination in retail meat may depend on the number of samples studied, storage conditions, retail environment, and season. In our country, the meat sold in the markets may have a relatively high rate of contamination depending on the fact that it is sold at room temperature in all seasons, is sold in the open market, and is not transported by special vehicles from the meat preparation places.

According to our study, in the markets of Ulaanbaatar, S. aureus was identified in 35% of the retail meat samples. There have been reported many studies around the world. In these studies, S. aureus was determined between 16% and 54.4% of the raw beef samples [23,24,25,26,27]. For instance in a study in Iran by Zeinab Torki, S. aureus was found in 16% of raw beef for retail sale, [23] in a study by Bizuneh Tsehaynah, 54.5%, [24] and in a study by Qianting Ou, and 29.2% [25]. In a study conducted in Japan, it was also reported that 32.8% of the raw beef samples were contaminated by S.aureus [26]. Moreover, a study showed that 40% of item contaminated by S. aureus, 77.8% and 47.2% of which had resistance at tetracycline and clindamycin, respectively [28]. As compared with other countries, level of the beef contamination was similar to the item but antibiotic resistance was higher than that of another country. By result of study conducted in Turkey, 63.54% of the meat samples was contaminated with S. aureus and its antibiotic resistance was observed each antibiotic for example, oxacillin 12.5%, tetracycline 26.03%, chloramphenicol 23.96%, penicillin 78.2%, clindamycin 16.66%, and azithromycin 46.87% [27].

In Mongolia, 35% of the beef samples was contaminated by S. aureus and its antibiotic resistance including oxacillin 88.6%, tetracycline 22.8%, chloramphenicol 8.6%, penicillin 88.6%, clindamycin 37.1%, and azithromycin 34.3% was observed in our study. Hence, the contamination of retail beef samples is considered as public health hazard in Mongolia.

Since the prevalence of bacterial infections and inflammatory diseases among the population in our country has not decreased significantly, the use of antibiotics as drug treatments has been increasing year over year, the side effects of drugs have increased, and pathogenic bacteria have become resistant to antibiotics and more virulent [29].

In Mongolia, approximately 70% of all drugs are imported, and approximately 30% of the drugs used for treatment are antibacterial agents. Additionally, more than 700 drugs are registered in the state register for animal husbandry practice, but there are risks of serious damage to human health due to the haphazard and uncontrolled use of antibiotics, the use of drugs in food before it has been completely excreted, and infection with antibiotic-resistant bacteria [29]. Common food products such as contaminated raw meat and meat products are a common way by which antibiotic-resistant bacteria spread from animals to humans [30, 31]. In other words, the improper use of antibiotics in animals can lead to high levels of antibiotic resistance in S. aureus strains found in meat and meat products [1]. Antibiotic resistance is likely to increase, depending on factors such as the number of animals, the improper use of antibiotics, and use of animal feed containing antibiotics.

Uncontrolled large-scale use of antibiotics is the basis for the emergence of MDR strains, and MDR S. aureus is quite common in hospital environments and on farms [32]. In a study conducted in the Federal Democratic Republic of Nepal, all 6 strains of S. aureus detected in meat were identified as resistant to antibiotics, especially amoxicillin and tetracycline [33, 34]. Additionally, in a study conducted by Pesavento G. in 2007, the staphylococcal strains detected were resistant to beta-lactam antibiotics such as oxacillin and cefoxitin, and 30.95% of them were identified as MDR. According to the results of this study, most of the staphylococci were resistant to beta-lactam antibiotics such as oxacillin and ciprofloxacin. It was found that 43 (89.58%) out of 48 S. aureus strains were highly resistant to beta lactam antibiotics [35]. Forty percent (14/35) of the S. aureus strains detected in the raw meat samples included in our study were MDR, while 1 strain was resistant to all 9 antibiotics in all of the 7 groups selected.

The prevalence of MRSA in China and Russia, which border Mongolia, is 10–50%, which is very high, showing that this type of research is necessary in our country. In our study, 17.1% (6/35) of the S. aureus detected in raw beef were MRSA. Over the past decade, MRSA strains have become serious pathogens that are resistant to antibacterial therapy and have spread to many regions of the world. Therefore, the rapid detection and diagnosis of MRSA is important to improve treatment outcomes, prevent the spread of infection, and reduce the risk of patient mortality.

Staphylococcal enterotoxins are the most important cause of foodborne illness [34]. Enterotoxins are highly stable toxins that are resistant to proteolytic enzymes such as pepsin, trypsin, and chymotrypsin. The heat resistance of enterotoxins vary depending on the pH and salt concentration of the environment, but on average, these toxins can withstand an environment at 100 °C for 30 min [36].

When meat contaminated with S. aureus is undercooked or stored at inappropriate temperatures, enterotoxins accumulate and cause staphylococcal food poisoning. In a study conducted in Taiwan from 2001 to 2003, tsst (59.1%), sea (29.2%), and sed (2%) were identified in 147 of the S. aureus strains found in patients that were associated with staphylococcal food poisoning outbreaks [37]. According to Sarrafzadeh's study, more than 50% of food poisoning caused by staphylococci was caused by enterotoxin A [38].

In our study, tsst was found in 17.1% of the samples, sea in 17.1%, and sed in 2.9%, which indicates the risk of food poisoning caused by S. aureus enterotoxin in our country. According to Hoveida L 's study, enterotoxins were found in 20.5% of the meat samples in which S. aureus was detected, and the virulence genes sec (19%), sea (9.5%), and tsst (3.5%) were identified [39]. In the study by Manisha in 2000, 24.3% of the S. aureus were positive for tsst, and 19.6% were positive for sea [40]. According to our study, enterotoxin A (sea) and toxic shock syndrome toxin (tsst) were each present in 17.1% (6/35) of the samples, exotoxin A was in 5.7% (2/35), and type b was in 11.4% (4/35), while enterotoxin D (sed) was detected in 2.9% (1/35), which is similar to the results of previous researchers.

Identifying the comparison of the virulence genes detection between antibiotic resistant and susceptibility strain groups, there were no statistically significant differences between the two groups in this study. Similarly, the toxin or virulence genes were tested in the resistant strains and it has not been identified in half of the resistant strains [41]. The study of virulence genes differences between MRSA and Methicillin-susceptible S. aureus (MSSA) reported that the virulence genes such as sea gene were higher in MRSA isolates, but tsst genes were not statistically significant difference both groups [42]. On the other hand, the prevalence of sed and tsst genes was significantly higher in MRSA than MSSA isolates by the study of comparative analysis of the prevalence of virulence genes between MRSA and MSSA isolates using the Chi-square and Fisher’s exact test [43]. The difference of previous and study results might depend on the isolated strain, its virulence, sample type and size for isolating S. aureus and geographical areas.

Food contaminated with highly toxic and antibiotic-resistant S. aureus, especially MRSA, can pose a serious threat to public health. An effective reduction of staphylococcal contamination levels could be achieved by improving sanitation and hygiene procedures. Therefore, there is an urgent need to develop methods and strategies to control hygiene when handling retail meat, prevent bacterial contamination, and detect contamination quickly.

Also, the contact between processed foods and unprocessed foods must be avoided. In order to ensure food safety, there is a need to expand research on detecting virulence factors responsible for food poisoning and antibiotic resistance. Prudent use of antibiotics in veterinary medicine is recommended and also education on the proper use of antibiotics should be prioritized for livestock farmers.

Conclusion

Our study concluded that S. aureus contamination is high in raw meat for retail sale, and these strains are resistant to antibiotics. This contamination is a high risk of food poisoning and the possibility of complications in its treatment. In our study, S. aureus strains isolated from meat contain a number of genes that are encoding heat-resistant and nonresistant virulence factors and subsequently, these strains are highly pathogenic. According to our study, the proper hygienic condition is to needed for meat preparation and sale.

Limitation of the study

Due to limitations of the funding of the research, 4 retail markets, limited samples and selective bacterial strains were included in our study. We plan to conduct further study in detail.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

References

  1. Haskell KJ, Schriever SR, Fonoimoana KD, Haws B, Hair BB, Wienclaw TM, et al. Antibiotic resistance is lower in Staphylococcus aureus isolated from antibiotic-free raw meat as compared to conventional raw meat. PLoS One. 2018;13(12):e0206712. https://0-doi-org.brum.beds.ac.uk/10.1371/journal.pone.0206712.

  2. APark S, Jung D, Altshuler I, et al. A longitudinal census of the bacterial community in raw milk correlated with Staphylococcus aureus clinical mastitis infections in dairy cattle. Anim Microbiome. 2022; 4: 59. https://0-doi-org.brum.beds.ac.uk/10.1186/s42523-022-00211-x.

  3. Arslan S, Özdemir F. Molecular characterization and detection of enterotoxins, methicillin resistance genes and antimicrobial resistance of Staphylococcus aureus from fish and ground beef. Pol J Vet Sci. 2017;20(1):85–94. https://0-doi-org.brum.beds.ac.uk/10.1515/pjvs-2017-0012.

    Article  CAS  PubMed  Google Scholar 

  4. Liu J, Wang X, Bi C, Ali F, Saleem MU, Qin J, Ashfaq H, Han Z and Alsayeqh AF. Epidemiological investigation of Staphylococcus aureus infection in dairy cattle in Anhui, China. Pak Vet J. 2022;42(4): 580–3. https://0-doi-org.brum.beds.ac.uk/10.29261/pakvetj/2022.042.

  5. Javed MU, Ijaz M, Fatima Z, Anjum AA, Aqib AI, Ali MM, Rehman A, Ahmed A and Ghaffar A. Frequency and antimicrobial susceptibility of methicillin and vancomycin-resistant Staphylococcus aureus from bovine milk. Pak Vet J. 2021;41(4):463–8. https://0-doi-org.brum.beds.ac.uk/10.29261/pakvetj/2021.060.

  6. Wu S, Huang J, Wu Q, Zhang J, Zhang F, Yang X, et al. Staphylococcus aureus Isolated From Retail Meat and Meat Products in China: Incidence, Antibiotic Resistance and Genetic Diversity. Front Microbiol. 2018;9:2767. https://0-doi-org.brum.beds.ac.uk/10.3389/fmicb.2018.02767.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Tang Y, Larsen J, Kjeldgaard J, Andersen PS, Skov R, Ingmer H. Methicillin-resistant and -susceptible Staphylococcus aureus from retail meat in Denmark. Int J Food Microbiol. 2017;249:72–6. https://0-doi-org.brum.beds.ac.uk/10.1016/j.ijfoodmicro.2017.03.001.

    Article  CAS  PubMed  Google Scholar 

  8. National statistics office of Mongolia. Statistical database. Ulaanbaatar: 2017. Available from: https://www.nso.mn/en.

  9. Hu D-L, Wang L, Fang R, Okamura M, Ono HK. Chapter 3 - Staphylococcus aureus Enterotoxins. In: Fetsch A, editor. Staphylococcus aureus. Academic Press; 2018. p. 39–55.

    Chapter  Google Scholar 

  10. Schelin J, Wallin-Carlquist N, Cohn MT, Lindqvist R, Barker GC, Rådström P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence. 2011;2(6):580–92. https://0-doi-org.brum.beds.ac.uk/10.4161/viru.2.6.18122.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Oliveira D, Borges A, Simões M. Staphylococcus aureus Toxins and Their Molecular Activity in Infectious Diseases. Toxins (Basel). 2018;10(6); https://0-doi-org.brum.beds.ac.uk/10.3390/toxins10060252.

  12. Ahmed A, Ijaz M, Khan JA, Anjum AA. Molecular characterization and therapeutic insights into biofilm positive Staphylococcus aureus isolated from bovine subclinical mastitis. Pak Vet J. 2022;42(4):584–90. http://0-dx-doi-org.brum.beds.ac.uk/10.29261/pakvetj/2022.078.

  13. Malik F, Nawaz M, Anjum AA, Firyal S, Shahid MA, Irfan S, Ahmed F, Bhatti AA. Molecular characterization of antibiotic resistance in poultry gut origin Enterococci and horizontal gene transfer of antibiotic resistance to Staphylococcus aureus. Pak Vet J. 2022; 42(3): 383–389. https://0-doi-org.brum.beds.ac.uk/10.29261/pakvetj/2022.035.

  14. Martínez-Vázquez AV, Guardiola-Avila IB, Flores-Magallón R, et al. Detection of multi-drug resistance and methicillin-resistant Staphylococcus aureus (MRSA) isolates from retail meat in Tamaulipas, Mexico. Ann Microbiol. 2021;71:16. https://0-doi-org.brum.beds.ac.uk/10.1186/s13213-021-01627-7.

    Article  CAS  Google Scholar 

  15. Goksoy EO, Kirkan S, Bardakcioglu HE, Parin U, et al. Evaluation of The Effects of Milking Hygiene and Sanitation Education on Total Bacterial and Somatic Cell Number of Bulk Tank Milk in Dairy Cattle Breeding. Int J Vet Sci. 2021;10(1):37–42. https://0-doi-org.brum.beds.ac.uk/10.47278/journal.ijvs/2020.009.

  16. Guardabassi L, O’Donoghue M, Moodley A, Ho J, Boost M. Novel lineage of methicillin-resistant Staphylococcus aureus, Hong Kong. Emerg Infect Dis. 2009;15(12):1998–2000. https://0-doi-org.brum.beds.ac.uk/10.3201/eid1512.090378.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Larsen J, Raisen CL, Ba X, Sadgrove NJ, Padilla-González GF, Simmonds MSJ, et al. Emergence of methicillin resistance predates the clinical use of antibiotics. Nature. 2022;602(7895):135–41. https://0-doi-org.brum.beds.ac.uk/10.1038/s41586-021-04265-w.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Smith TC, Male MJ, Harper AL, Kroeger JS, Tinkler GP, Moritz ED, et al. Methicillin-resistant Staphylococcus aureus (MRSA) strain ST398 is present in midwestern U.S. swine and swine workers. PLoS One. 2009;4(1):e4258. https://0-doi-org.brum.beds.ac.uk/10.1371/journal.pone.0004258.

  19. Haaber J, Penadés JR, Ingmer H. Transfer of Antibiotic Resistance in Staphylococcus aureus. Trends Microbiol. 2017;25(11):893–905. https://0-doi-org.brum.beds.ac.uk/10.1016/j.tim.2017.05.011.

    Article  CAS  PubMed  Google Scholar 

  20. Parvez MAK, Ferdous RN, Rahman MS, Islam S. Healthcare-associated (HA) and community-associated (CA) methicillin resistant Staphylococcus aureus (MRSA) in Bangladesh - Source, diagnosis and treatment. J Genet Eng Biotechnol. 2018;16(2):473–8. https://0-doi-org.brum.beds.ac.uk/10.1016/j.jgeb.2018.05.004.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Zhang Y, Xu D, Shi L, Cai R, Li C, Yan H. Association Between agr Type, Virulence Factors, Biofilm Formation and Antibiotic Resistance of Staphylococcus aureus Isolates From Pork Production. Front Microbiol. 2018;9:1876. https://0-doi-org.brum.beds.ac.uk/10.3389/fmicb.2018.01876.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Hannah R, Pablo R, Max R. Meat and Dairy Production. Published online at OurWorldInData.org. 2019. Retrieved from: https://ourworldindata.org/meat-production. [Online Resource].

  23. Torki Baghbaderani Z, Shakerian A, Rahimi E. Phenotypic and Genotypic Assessment of Antibiotic Resistance of Staphylococcus aureus Bacteria Isolated from Retail Meat. Infect Drug Resist. 2020;13:1339–49. https://0-doi-org.brum.beds.ac.uk/10.2147/idr.S241189.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Tsehayneh B, Yayeh T, Agmas B. Evaluation of Bacterial Load and Antibiotic Resistance Pattern of Staphylococcus aureus from Ready-to-Eat Raw Beef in Bahir Dar City, Ethiopia. Int J Microbiol. 2021;2021:5560596. https://0-doi-org.brum.beds.ac.uk/10.1155/2021/5560596.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Ou Q, Peng Y, Lin D, Bai C, Zhang T, Lin J, et al. A Meta-Analysis of the Global Prevalence Rates of Staphylococcus aureus and Methicillin-Resistant S. aureus Contamination of Different Raw Meat Products. J Food Prot. 2017;80(5):763–74. https://0-doi-org.brum.beds.ac.uk/10.4315/0362-028x.Jfp-16-355.

  26. Hiroi M, Kawamori F, Harada T, Sano Y, Miwa N, Sugiyama K, Hara-Kudo Y, Masuda T. Antibiotic resistance in bacterial pathogens from retail raw meats and food-producing animals in Japan. J Food Prot. 2012;75(10):1774–82. https://0-doi-org.brum.beds.ac.uk/10.4315/0362-028XJFP-11-479.

    Article  CAS  PubMed  Google Scholar 

  27. Şanlıbaba P. Prevalence, antibiotic resistance, and enterotoxin production of Staphylococcus aureus isolated from retail raw beef, sheep, and lamb meat in Turkey. Int J Food Microbiol. 2022; 361: 109461, ISSN 0168–1605. https://0-doi-org.brum.beds.ac.uk/10.1016/j.ijfoodmicro.2021.109461.

  28. Tegegne HA, Koláčková I, Florianová M, Gelbíčová T, Madec JY, Haenni M, Karpíšková R. Detection and molecular characterisation of methicillin-resistant Staphylococcus aureus isolated from raw meat in the retail market. J Glob Antimicrob Resist. 2021;26:233–8. https://0-doi-org.brum.beds.ac.uk/10.1016/j.jgar.2021.06.012. (Epub 2021 Jul 14 PMID: 34271219).

    Article  CAS  PubMed  Google Scholar 

  29. Tsetsegmaa S, Erdenechimeg E, Gereltuya D, et al. Surveillance Study Of Antibiotic Use In Mongolia [Internet], Ulaanbaatar: Ministry of health, Mongolia; 2018. Available from: http://www.hdc.gov.mn/media/files/7_JMJu9P2.pdf.

  30. Yehia HM, Ismail EA, Hassan ZK, Al-Masoud AH, Al-Dagal MM. Heat resistance and presence of genes encoding staphylococcal enterotoxins evaluated by multiplex-PCR of Staphylococcus aureus isolated from pasteurized camel milk. Biosci Rep. 2019;39(11). https://0-doi-org.brum.beds.ac.uk/10.1042/bsr20191225.

  31. Le Loir Y, Baron F, Gautier M. Staphylococcus aureus and food poisoning. Genet Mol Res. 2003;2(1):63–76.

    PubMed  Google Scholar 

  32. Sakoulas G, Moellering RC Jr. Increasing antibiotic resistance among methicillin-resistant Staphylococcus aureus strains. Clin Infect Dis. 2008;46(Suppl 5):S360–7. https://0-doi-org.brum.beds.ac.uk/10.1086/533592.

    Article  CAS  PubMed  Google Scholar 

  33. Johler S, Sihto HM, Macori G, Stephan R. Sequence Variability in Staphylococcal Enterotoxin Genes seb, sec, and sed. Toxins (Basel). 2016;8(6). https://0-doi-org.brum.beds.ac.uk/10.3390/toxins8060169.

  34. Saud B, Paudel G, Khichaju S, Bajracharya D, Dhungana G, Awasthi MS, et al. Multidrug-Resistant Bacteria from Raw Meat of Buffalo and Chicken. Nepal Vet Med Int. 2019;2019:7960268. https://0-doi-org.brum.beds.ac.uk/10.1155/2019/7960268.

    Article  CAS  PubMed  Google Scholar 

  35. Pesavento G, Ducci B, Comodo N, Nostro AL. Antimicrobial resistance profile of Staphylococcus aureus isolated from raw meat: A research for methicillin resistant Staphylococcus aureus (MRSA). Food Control. 2007;18(3):196–200. https://0-doi-org.brum.beds.ac.uk/10.1016/j.foodcont.2005.09.013.

    Article  CAS  Google Scholar 

  36. Erkmen O. Practice 21 - Isolation and counting of Staphylococcus aureus. In: Erkmen O, editor. Microbiological Analysis of Foods and Food Processing Environments. Academic Press; 2022. p. 229–41.

    Chapter  Google Scholar 

  37. Chiang Y-C, Liao W-W, Fan C-M, Pai W-Y, Chiou C-S, Tsen H-Y. PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. Int J Food Microbiol. 2008;121(1):66–73. https://0-doi-org.brum.beds.ac.uk/10.1016/j.ijfoodmicro.2007.10.005.

    Article  CAS  PubMed  Google Scholar 

  38. Sarrafzadeh Zargar M, Hosseini Doust R, Mohebati MA. Staphylococcus aureus enterotoxin A gene isolated from raw red meatand poultry in Tehran, Iran. Int J Enteric Pathogens. 2014;2(3):1–6. https://0-doi-org.brum.beds.ac.uk/10.17795/ijep16085.

    Article  Google Scholar 

  39. Hoveida L, Ataei B, Amirmozafari N, Noormohammadi Z. Species Variety, Antibiotic Susceptibility Patterns and Prevalence of Enterotoxin Genes in Staphylococci Isolated from Foodstuff in Central Iran. Iran J Public Health. 2020;49(1):96–103.

    PubMed  PubMed Central  Google Scholar 

  40. Mehrotra M, Wang G, Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol. 2000;38(3):1032–5. https://0-doi-org.brum.beds.ac.uk/10.1128/jcm.38.3.1032-1035.2000.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Fernandes A, Ramos C, Monteiro V, Santos J, Fernandes P. Virulence Potential and Antibiotic Susceptibility of S. aureus Strains Isolated from Food Handlers. Microorganisms. 2022;10(11). https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms10112155.

  42. Wang M, Zhang Q. Characteristics of Virulence Genes of Clinically Isolated Staphylococci in Jingzhou Area. Contrast Media Mol Imaging. 2022;2022:8804616. https://0-doi-org.brum.beds.ac.uk/10.1155/2022/8804616.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Pumipuntu N, Tunyong W, Chantratita N, Diraphat P, Pumirat P, Sookrung N, et al. Staphylococcus spp. associated with subclinical bovine mastitis in central and northeast provinces of Thailand. PeerJ. 2019; 7:e6587. https://0-doi-org.brum.beds.ac.uk/10.7717/peerj.6587.

Download references

Acknowledgements

We would like to express our gratitude to the management of Etugen University for the financial aid and to the staff of the Mongolian National University of Medical Sciences, School of Biomedicine, Department of Molecular Biology and Genetics, who provided the laboratory facilities.

Funding

This study did not receive any specific project funds.

Author information

Author notes

  1. Amgalanzaya Dorjgochoo and Anujin Batbayar have contributed equally to this work.

Authors and Affiliations

  1. Department of Biomedicine, Etugen University, Ulaanbaatar, Mongolia

    Amgalanzaya Dorjgochoo

  2. Department of Molecular Biology and Genetics, School of Biomedicine, Mongolian National University of Medical Sciences, Ulaanbaatar, Mongolia

    Amgalanzaya Dorjgochoo, Altansukh Tsend-Ayush, Otgontsetseg Erdenebayar, Bayarlakh Byambadorj, Jav Sarantuya & Munkhdelger Yandag

  3. Global Leadership University, Ulaanbaatar, Mongolia

    Anujin Batbayar

Authors
  1. Amgalanzaya Dorjgochoo
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Anujin Batbayar
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Altansukh Tsend-Ayush
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Otgontsetseg Erdenebayar
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Bayarlakh Byambadorj
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Jav Sarantuya
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Munkhdelger Yandag
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Amgalanzaya Dorjgochoo and Anujin batbayar conceived and designed this study; contributed to acquisition, analysis and interpretation of the data; and was responsible for drafting, editing and submission of the manuscript. Sarantuya Jav had a significant influence on the study design and critical appraisal of the manuscript. Otgontsetseg Erdenebayar and Bayarlakh Byambadorj contributed to the study design and acquire the samples. Altansukh Tsend-Ayush contributed to the interpretation of the data. Munkhdelger Yandag contributed to the study design and analysis and interpretation of the data and reviewed the manuscript. All of the authors reviewed, discussed, and approved the final manuscript.

Corresponding authors

Correspondence to Jav Sarantuya or Munkhdelger Yandag.

Ethics declarations

Ethics approval and consent to participate

The IRB Committee of the Mongolian National University of Medical Sciences approved the study protocol (№2022/3–02, approved on 2/18/2022).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Dorjgochoo, A., Batbayar, A., Tsend-Ayush, A. et al. Detection of virulence genes of Staphylococcus aureus isolated from raw beef for retail sale in the markets of Ulaanbaatar city, Mongolia. BMC Microbiol 23, 372 (2023). https://0-doi-org.brum.beds.ac.uk/10.1186/s12866-023-03122-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12866-023-03122-2

Keywords

BMC Microbiology

ISSN: 1471-2180

Contact us