Figure 8
From: Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus
Southern blot analysis of two A. flavus transformants SOD#5 and SOD#30 after deletion of a putative superoxide gene ( GenBank No: CA747446) using an overlap PCR technique with pyr4 as a selectable marker. (A) Genomic DNA digested with Kpn I or BamH I and run on an 0.8% agrose gel. (B) Southern hybridization using N. crassa pyr4 as a probe amplified from plasmid pBSK-pyr4 with the following primer pairs: Pyr-F, 5' TTGGACCACACGAGTCAAG 3' and Pyr4-R, 5' GAAAACGAAATATCCTCCGCC 3'. Lanes 1 & 5 are SOD#5; Lanes 2 & 6 are SOD#30; Lanes 3 & 7 are 3357-5; Lane 4 is blank. Lanes 1–3 digested with Kpn I; Lanes 5–7 digested with BamH I. The two bands in lane 2 suggest multiple integrations in SOD#30.