Fluorescence in situ Hybridization method using Peptide Nucleic Acid probes for rapid detection of Lactobacillus and Gardnerella spp.

Table 2 Theoretical specificity and sensitivity of several primers and probes for Lactobacillus and Gardnerella spp. detection

Probe	Type	Sequence (5´→3´)	No. of Lactobacillus strains detected ^a	No. of non- Lactobacillus strains detected ^a	Specificity (%)^a	Sensibility (%)^a	Reference or source
Lab158^b	DNA	GGTATTAGCA(C/T)CTGTTTCCA	11,991	7,165	99.30^g	92.69 ^g	[28]
LGC354A^c	DNA	TGGAAGATTCCCTACTGC	12,701	12,329	98.79 ^g	98.18 ^g	[29]
LAB759^e	DNA	CTACCCATRCTTTCGAGCC	10,371	2,823	99.72 ^g	80.17 ^g	[30]
Name not available	PNA	CCATTGTGGAAGATTC	12,930	14,880	98.54 ^g	99.95 ^g	[31]
Lac663	PNA	ACATGGAGTTCCACT	11,837	3,548	99.65 ^g	91.50 ^g	[26]
GardV	DNA	CCACCGTTACACCGAGAA	20	39	99.99	50.00	[10]
G.vag1008^f	DNA	CTGCAGAGATGTGGTTTCCYTTCG	39	7	100.00	97.50	[32]
G.vag198	DNA	CCACTAAACACTTTCCCAACAAGA	34	0	100.00	85.00	[6]
GV003	DNA	AGACGGCTCCATCCCAAAAGGGTT	32	0	100.00	80.00	[33]
Gard162	PNA	CAGCATTACCACCCG	38	1	100.00	95.00	This work

^a Calculated through ProbeMatch/, last accession, May 2012) with the following data set options: Strain – Both; Source – Both; Size – > 1200 bp; Quality – Both.
^b DNA probe that also detects members of Enterococcus, Pediococcus, Weissella, Vagococcus, Leuconostoc and Oenococcus spp. used by Lebeer et al. [34].
^c DNA probe mainly detecting members of Lactobacillales and Bacillales, such as Lactobacillus spp., used in Olsen et al. [35].
^e DNA probe also detects members of Ruminococcaceae sp. and Pediococcus sp. used in Quevedo et al. [36]; The R symbol of the DNA probe sequence may be Adenosine or Guanosine, therefore Quevedo et al. [36] used a degenerate base in the sequence of the DNA probe to detect Lactobacillus spp.
^f The Y symbol of the DNA probe sequence may be Cytidine or Thymidine, therefore Fredricks et al. [6] used a degenerate base in the sequence of the DNA probe to detect G. vaginalis
^g Values determined in Machado et al.[26].

ISSN: 1471-2180