Table 1 Gene locus, given names, features, gene conservation, sequence of the primers employed for DNA amplification, and molecular mass of expressed recombinant proteins
Gene locus1 | Given name2 | Description/ Function | Conservation (identity)3 | Sequence of primers for PCR amplification | Molecular mass |
|---|---|---|---|---|---|
LIC11834 | Lsa33 | Putative lipoprotein | Lai (99%) LBH (87%) LBP (31%) | F:5′CTCGAG GATCTACAAGGTGGGGTTTTTAC3′ XhoI R:5′CCATGG TTACTGAGGTTTTACTTGGTCC3′ NcoI | 33.1 kDa |
LIC12253 | Lsa25 | Conserved hypothetical protein | Lai (100%) LBH (77%) LBP (39%) | F:5′ CTCGAG GAGGAGAAACCGGACGATAC 3′ XhoI R:5′CCATGG TTAGGGAAGACTTCTAACACATC3′ NcoI | 24.07 kDa |