Plasmid | Relevant characters | Reference |
---|---|---|
pAZ101 | pGZ119HE derivative, harbours the pnp + allele | [58] |
pAZ1112 | pAZ101 derivative; harbours the pnp-S438A allele encoding a catalytically inactive PNPase | [24] |
pAZ1113 | pAZ101 derivative; harbours the pnp-74 allele (ΔKH 603–615) under the control of pnp P2 promoter. Obtained by cloning the AgeI-BsiWI fragment of pnp-74 from pEJ04 in the large AgeI-BsiWI fragment of pAZ101. | this work |
pAZ1114 | pAZ101 derivative; harbours the pnp-78 allele (ΔS1 622–633) under the control of pnp-p2 promoter. Obtained by cloning the AgeI-BsiWI fragment of pnp-78 from pEJ08 in the large AgeI-BsiWI fragment of pAZ101. | this work |
pAZ1115 | pGZ119HE derivative; harbours the rnb + allele under the control of its own rnb-p promoter. Obtained by cloning into pGZ119HE a BamHI-HindIII-digested PCR fragment amplified from MG1655 DNA with primers FG3063 (CGGGATCCTGCAAGGGCGAAAATG) and FG3086 (CCCAAGCTTCATGAAATTAACGGCGGC) encompassing chromosomal coordinates 1,349,209-1,344,800 (NCBI Sequence ID U00096.3). | this work |
pAZ133 | pAZ101 derivative, harbours the Δpnp-833 allele encoding Pnp-ΔKHS1 | [23] |
pEJ04 | Harbours the pnp-74 allele under T5 promoter-lacO operator control | [22] |
pEJ08 | Harbours the pnp-78 allele under T5 promoter-lacO operator control | [22] |
pGZ119HE | ColD, CamR | [50] |