Skip to main content

Table 1 Characteristics of Melt-MAMA primers designed for six major branches containing Italian Brucella abortus isolates. Genome position is in the reference strain 2308, all in chromosome I

From: Origins and global context of Brucella abortus in Italy

Branch Location in B. abortus 2308 SNP allele Melt-MAMA primer Melt-MAMA Primer sequences (5′ to 3′) PCR mix Concentration Annealing Temp. Melting Temp.
Branch 1
West Italia
951620
NC_007618.1
C/T A GCGACCGCATCCTCTAaTC 0.4 μM   80.8 ° C
D cggggcggggcggggGCGACCGCATCCTCTAcTT 0.1 μM 56 ° C 83.4 ° C
C CATGGTAGGCAGGCTGGTT 0.5 μM   
Branch 2 1336380 A/G A CGAAGTTTCCCGACACCcA 0.4 μM   81.2 ° C
West Italia NC_007618.1   D cggggcggggcggggCGAAGTTTCCCGACACCtG 0.1 μM 56 ° C 83.9 ° C
    C GATGAAGAAATCGATGAGCG 0.5 μM   
Branch 1 104052 G/T A TGGAGGACGAAGTCTTCGaTG 0.25 μM   78 ° C
East Italia NC_007618.1   D cggggcggggcggggGGAGGACGAAGTCTTCGcTT 0.25 μM 56 ° C 82.9 ° C
    C ATCCTCGACAGTTGCGGC 0.5 μM   
Branch 2 360724 C/A A TACCGCGGCCCGTCTAtC 0.25 μM   81.6 ° C
East Italia NC_007618.1   D cggggcggggcggggTACCGCGGCCCGTCTAaA 0.25 μM 56 ° C 83.7 ° C
    C AATCAAAGCGGCTTGCCTC 0.5 μM   
Branch 1 740090 T/C A CAAAAGCGGACGGTCAgAT 0.4 μM   78.9 ° C
Trans Italia NC_007618.1   D cggggcggggcggggTCAAAAGCGGACGGTCAtAC 0.1 μM 56 ° C 80.9 ° C
    C CCCTCAACCCAGACGTTCG 0.5 μM   
Branch 2 864308 C/T A AGGCATTACCGTTTCAGATTtC 0.4 μM   78.5 ° C
Trans Italia NC_007618.1   D cggggcggggcggggAGGCATTACCGTTTCAGATTaT 0.1 μM 56 ° C 81.9 ° C
    C TCTTTCCCGGCTCCGAAT 0.5 μM   
  1. Melt-MAMA primer abbreviations: A ancestral, D derived, C common
  2. Details of primers concentration used in each reaction with proper annealing temperature is given. Melting temperatures detected for both the amplicons derived by the specific primer binding is given according to the experiments run on an Applied Biosystems 7500 Real-Time PCR System