Skip to main content

Advertisement

Table 3 Oligonucleotides utilized in the study

From: Consensus computational network analysis for identifying candidate outer membrane proteins from Borrelia spirochetes

Primer Name Sequence 5’-3’a Description
BB0838 (2362) F GCGGCTAGCTTATCTGATCCGGAAACTTTTTA Cloning bb0838 (2362) into the pET23a vector
BB0838 R GCGCTCGAGTCTATTAATAATAAACTCGTAGTTT Cloning bb0838 (2362) into the pET23a vector
BB0405 F GCGGCTAGCTCCAAAAGCAAAAGTATGACTG Cloning bb0405 into the pET23a vector
BB0405 R GCGCTCGAGTATATATATTTTTATAAAGCCTGTG Cloning bb0405 into the pET23a vector
BB0406 F GCGGGATCCTCTTTTGCATCTGACAATTATATG Cloning bb0406 into the pET23a vector
BB0406 R GCGCTCGAGTGCAAATTTTATGAATCCAAATCC Cloning bb0406 into the pET23a vector
BB0838 RT 3’ ATCTTTAGTAAGTCCATAAGTGAAATTTT cDNA synthesis for uvrA-bb0838 PCR reaction
UvrA RT 3’ GAGCCACTCTTGCCAGATATTA cDNA synthesis for uvrB-uvrA PCR reaction
BB0406 RT 3’ AATTCTTATAACAGCGCCTATTCTCTCATA cDNA synthesis for bb0405-bb0406 PCR reaction
BB0405 RT 3’ CATAGTTGTTCCAATAGTAGCAACAGC cDNA synthesis for bb0404-bb0405 PCR reaction
UvrB PCR 5’ GATTGTCTAAAAAAAAGCTTATTGATAAG RT-PCR of uvrB-uvrA
UvrA PCR 3’ TGGAATATCTACATCAACATTTTTTAAATT RT-PCR of uvrB-uvrA
UvrA PCR 5’ GTTTCTGGTATTCCTGAAGAGG RT-PCR of uvrA-bb0838
BB0838 PCR 3’ CCAGATCCGGCAAGTCCC RT-PCR of uvrA-bb0838
BB0404 PCR 5’ ATTAATGGCCTAAAGTTAGCTTCAAAAAG RT-PCR of bb0404-bb0405
BB0405 PCR 3’ GCTGTACTCTATTACCAAAGGCAA RT-PCR of bb0404-bb0405
BB0405 PCR 5’ GTTGTGATGGGTGTAGATCTTCT RT-PCR of bb0405-bb0406
BB0406 PCR 3’ AATTCTTATAACAGCGCCTATTCTCTCATA RT-PCR of bb0405-bb0406
  1. aRestriction enzymes noted in bold