Skip to main content

Table 1 Oligonucleotide primers and PCR conditions used in this study

From: Development of a transformation system for Aspergillus sojae based on the Agrobacterium tumefaciens-mediated approach

Name/Sequence (5'-3')

Function

PCR conditions

ML1.3-F/TCCGGCGgcgcgcATCCTCTAGAAAGAAGGATTAC

Mutagenesis on pRFHUE-eGFP vector

ID: 94°C for 5 min.

ML1.3-F/TCCGGCGgcgcgcATCCTCTAGAAAGAAGGATTAC

5-cycle: 94°C for 15 sec, 60°C for 15 sec and 68°C for 3 min.

30-cycle: 94°C for 15 sec and 68°C for 3 min.

  

FE: 68°C for 5 min.

cla-F/GAGGAatcgatCCATGGCCAAGTTG

Amplification of ble gene from pGAPZαA vector

ID: 94°C for 5 min.

30-cycle: 94°C for 15 sec, 62°C for 15 sec and 68°C for 45 sec.

bam-R/TCggatccGTCAGTCCTGCTCCTCG

FE: 68°C for 5 min.

BLE-F/CGTTTTATTCTTGTTGACATGGAGC

Target ble gene contained on T-DNA

ID: 94°C for 5 min.

30-cycle: 94°C for 15 sec, 55°C for 15 sec and 68°C for 45 sec.

BLE-R/TTGGGCTTGGCTGGAGCTAGTGGAG

FE: 68°C for 5 min.

EGFP-F/ACCTACGGCAAGCTGACCCTGAAGT

Target egfp gene contained on T-DNA

ID: 94°C for 5 min.

30-cycle: 94°C for 15 sec, 60°C for 15 sec and 68°C for 45 sec.

EGFP-R/TGTACAGCTCGTCCATGCCGAGAGT

FE: 68°C for 5 min.

  1. Lowercase letters gcgcgc, atcgat and ggatcc indicate restriction sites BssHII, ClaI and BamHI respectively. The italicized sequences ATG and TCA, correspond to the star and stop codon, respectively. ID: initial denaturation; FE: final elongation.
Back to article page

BMC Microbiology

ISSN: 1471-2180

Contact us