Typing Clostridium difficile strains based on tandem repeat sequences

BMC Microbiology

Table 1 Characteristics of tandem repeat loci TR6 and TR10.

tandem repeat locus	Location^a	Size (bp)	Copy no. Range^b	No. of different repeats^b	Repeat consensus
TR6	725321 : 725600	21	7–37	80	CTTGCATACCACTAATAGTGC
TR10	3753166 : 3753574	22–23	4–26	51	AAATTAATTATTATATTTCTTT

^a Genome location based on C. difficile 630 sequence http://www.sanger.ac.uk.
^b Based on analysis of 154 isolates typed in this study.

ISSN: 1471-2180