Skip to main content

Advertisement

Table 1 Primers used in this study.

From: Diversity and transcription of proteases involved in the maturation of hydrogenases in Nostoc punctiforme ATCC 29133 and Nostocsp. strain PCC 7120

Strain/Target Oligonucleotide (name and sequence), 5'→3' Primer pair Product size (bp)
Nostoc punctiformeATCC 29133
RT-Reaction     
hupW- antisense HupW N R TCA CAT CAT CGG GAA AGT CA   
Subsequent PCR     
hupW-antisense HybD-RACE 1 TTC TGG CAA AGC TTC CAG TT L0373/L0372 808/1361
Npun_F0373-sense L0373 AAT TAT CTC CCT CGC GTT CC HybD-RACE 1 808
NpF0372-sense L0372 TTG CCG ATG AAA CAA ATG AA HybD-RACE 1 1361
Northern blot, probe     
hupW-antisense HupW N R TCA CAT CAT CGG GAA AGT CA NB hupW N 336
hupW-sense NB hupW N L TTG GTT GCG GAA ATC TCA AT HupW N R 336
5'RACE     
cDNA synthesis HybD-RACE 1 TTC TGG CAA AGC TTC CAG TT   
1 st PCR HybD-RACE 2 TGT TGG GCA ATG ATT ACA CCT   
2 nd PCR HybD-RACE 3 ATT GAG ATT TCC GCA ACC AA   
Nostoc sp. strain PCC 7120 – hupW
RT-Reaction     
hupW- antisense NB HupW- AR TGC TGT AGG CGT AAT CAT CG   
Subsequenct PCR     
hupW-antisense Alr1422-23 R TTT GTA AGC GTT GAG CGA TG Alr1422-23 L 490
Alr1422-sense Alr1422-23 L ACC GAA CTC CGC AGA AAC TA Alr1422-23 R 490
5'RACE     
cDNA synthesis ALR1423 RACE 1b GTT CCG AAC CAG TGG AAC TC   
1 st PCR ALR1423 RACE 2 TTT GTA AGC GTT GAG CGA TG   
2 nd PCR ALR1423 RACE 3 GAG ATT TCC GCA ACC GAT AA   
Nostoc sp. strain PCC 7120 – alr1422
5'RACE     
cDNA synthesis 5-1422-1 CCTAAAGTCGGTGGAAAATCGGC   
1 st PCR 5-1422-2 TTCTTCCGTGACAAATCGTG   
2 nd PCR 5-1422-3 TTTTTGATGGACGGATGACA   
Nostoc sp. strain PCC 7120 – hoxW
Northern blot, probe     
hoxW-antisense NB HoxW A R AAA GCG ATC GCC TAT TTC AA HoxW L 316
hoxW-sense HoxW L AGG ACA ACG GAT AGC GAA TG NB HoxW A R 316
5'RACE     
cDNA synthesis 5'RACE-1 HoxW/A CAC AGC ACG ACG AAC AAG GCT CCA ACT TCA AAC CA   
1 st PCR-TAG 5'RACE-TAG Hox/A CAC AGC ACG ACG AAC AAG G 5'RACE-polyG Hox/A  
1 st PCR-PolyG 5'RACE-polyG Hox/A CAC AGC ACG ACG AAC AAG GGG GGG GGG GG 5'RACE-TAG Hox/A