Bacterial strains, plasmids or primers* | Characteristic or sequence | Source or Remark |
---|---|---|
E. coli DH5α-pTOPOFL | DH5α harboring pCR4-TOPO containing lamB of A. pleuropneumia e CM5 | This work |
E. coli DH5α-TOPOΔFLcat | DH5a harboring pCR4-TOPO containing ΔlamB::cat | This work |
E. coli DH5Δ-pEMOC2-ΔlamB | DH5Δharboring pEMOC2 containing ΔlamB::cat | This work |
A. pleuropneumoniae CM5 ΔlamB | LamB negative mutant of A. pleuropneumoniae CM5 | This work |
pTOPOFL | pCR4-TOPO containing lamB of A. pleuropneumiae CM5 | This work |
TOPOΔFLcat | pCR4-TOPO containing ΔlamB::cat | This work |
pEMOC2-ΔlamB | pEMOC2 containing ΔlamB::cat | This work |
CrosslamB-L CrosslamB-R | GGTGGCGTAAAAGTAGGAGAT TGGTCATTATCCACCACCAA | Primers for the PCR amplification of the lamB gene of A. pleuropneumoniae CM5 |
stopuplamB-L | TTAGTTAGTTACAATATTTTCAACCCCTGCAC | Primers for the PCR generation of a linearized plasmid containing a deletion of 400 bp in the lamB gene cloned in pTOPOPCR-lamB |
stopuplamB-R | TAACTAACTAATCACGCACAAGGTTC AAAAG | Â |
PstcrosslamB-L NotcrosslamB-R | TCATCTGCAGGGTGGCGTAAAAGTAGGAGAT ACAATACAGCGGCCGCTGGTCATTATCCACCACCAA | Primer sequences for the PCR amplication of the ΔlamB::cat and the insertion of the PsT I and Not I sites into the PCR product |