Bacterial strains | Relevant properties | Source/Reference |
---|---|---|
Escherichia coli TOP10 | F-mcr A φ80lac Z_M15 lac X74rec A1ara D gal U rps L end A1 nup G | Invitrogen, UK. |
Bifidobacterium breve UCC2003 | Electroporation host | UCC Culture Collection. |
Plasmids | Relevant properties | Source/Reference |
pPl2lux | Allows for translational fusions to lux ABCDE operon | [2] |
pUC19 | 2.686 kb vector based on pMB1, Ampr | Fermentas |
pUC19-lux | pUC19 containing the 5.6 kb modified lux ABCDE operon as SalI – PstI fragment. | [2] |
pBC1.2 | Bifidobacterial shuttle vector based on pBC1, Cmr | [14] |
pLuxMC1 | pBC1.2 containing the modified lux ABCDE operon | This study |
pLuxMC2 | pBC1.2 containing the lux ABCDE operon plus promoter of repC from pBC1 | This study |
pLuxMC3 | pBC1.2 plus lux ABCDE operon with P help [3]. | This study |
Primers | Sequence | Source/Reference |
IM111 | Aaaaggacgatttcggttgg | [2] |
IM112 | Ccaatgccccagaaatttcc | [2] |
P rep F | Ccatccaactcgag gcacaagccgcgcgagcggtc | This study |
P rep R | Catgggcactagtgtacgtc | This study |