Skip to main content

Advertisement

Table 1 Nucleotide sequence of real-time qPCR primers

From: The expression and regulation of matrix metalloproteinase-3 is critically modulated by Porphyromonas gingivalis lipopolysaccharide with heterogeneous lipid A structures in human gingival fibroblasts

Primers Sequence (5-3)
MMP1-F ATG CTG AAA CCC TGA AGG TG
MMP1-R CTG CTT GAC CCT CAG AGA CC
MMP2-F AGG GCA CAT CCT ATG ACA GC
MMP2-R ATT TGT TGC CCA GGA AAG TG
MMP3-F GCA GTT TGC TCA GCC TAT CC
MMP3-R GAG TGT CGG AGT CCA GCT TTC
TIMP1-F CTG TTG TTG CTG TGG CTG AT
TIMP1-R TCC GTC CAC AAG CAA TGA GT
β-actin -F TTG GCA ATG AGC GGT T
β-actin -R AGTTGAAGGTAGTTTCGTGGAT