Skip to main content

Advertisement

Table 2 Primers used in this study

From: The mxd operon in Shewanella oneidensis MR-1 is induced in response to starvation and regulated by ArcS/ArcA and BarA/UvrY

Primer Sequence (5’-3’)
Pmxd-fw-SphI TCTTGGCATGCCATTATTAAATGACC
Pmxd-rv-XbaI TGTCATCTAGAAAACCTTGTACAGAT
LacZ-fw-XbaI GGAATCTAGAATGACCATGATTACGGATT
LacZ-rv-PstI AGAACTGCAGGCAAAAATAATACCCGTATC
Pmxd-fw-150-SphI CGTACTACGCATGCGATTAAAGCGAGTTTTGATATTC
Pmxd-fw-250-SphI CGTACTACGCATGCTTATTTTTATTTTGTTATTTTTTAATATTC
Pmxd-fw-300-SphI CGTACTACGCATGCTTCAGGGTGAACAATTGTATC
Pmxd-fw-HindIII GTACGTCAAAGCTTCATTATTAAATGACC
Pmxd-rv-XbaI TGTCATCTAGAAAACCTTGTACAGAT
SO1860_uvrY_F-O GCGAGCTAGAATAGGGCTAGGT
SO1860_uvrY_F-O TCTTGCTGCTCTGCCACTC
SO1860_uvrY_5-O CTCATTCTAAGCGCAGCTCCT
SO1860_uvrY_5-I AACCCGTCGGAGGGATAATTGCATAACTGGCATATTCATGTCC
SO1860_uvrY_3-I CAATTATCCCTCCGACGGGTTGAGAATCCGTTTAAAGCCTTATCTG
SO1860_uvrY_3-O ACTGCAGCGGGATAACTGGTA
SO3457_barA_F-O TTTATCATCGAGCAATTGGTAAACA
SO3457_barA_R-O GAGTTCAAGGTAATAATTGACTAAACG
SO3457_barA_5-O GTCGGCTGCAATCAACTCTAA
SO3457_barA_5-I ATCTATACGCTCGCGGTGTTCATGTTGTTGACAGGGTTCATA
SO3457_barA_3-I ACACCGCGAGCGTATAGATCTTTAAGCGTTTAAAAGCGCTAGAACTACCACA
SO3457_barA_3-O CGCTGTTTGTTAAGATAAATCCTTG
SO3988_arcA_I_rv AGTTACCACATACCCTTCTGCCTCG
SO3988_arcA_I_fw TGAGTCATGTTGTCCATCGGTAGTC
SO3988_arcA_check_rv GCGTTGCAGGACGAAGGCAAGTTG
SO3988_arcA_check_fw CAACGGCGTTTGATAATGCTGCCAC
SO3988_arcA_II_rv TCTAAGCATTCAATGCGTGG
SO3988_arcA_II_fw GTGACTATCCGTCGTATCCGTAAGC