Skip to main content

Advertisement

Table 1 Plasmids and oligonucleotide primers

From: Production of mycobacterial cell wall glycopeptidolipids requires a member of the MbtH-like protein family

Plasmid Characteristics Source or Reference
pCR2.1-TOPO Cloning vector, kanamycin resistance and ampicillin resistance genes Invitrogen
pCP0 Vector for gene expression in mycobacteria, kanamycin resistance gene [4]
pCP0-gplH pCP0 expressing M. smegmatis gplH This study
pCP0-mbtHMs pCP0 expressing M. smegmatis mbtH (MSMEG_4508) [35]
p2NIL Kanamycin resistance gene and OriE [57]
pGOAL19 Hygromycin resistance gene, sacB-lacZ PacI cassette, and OriE [57]
p2NIL-GOALc-ΔgplHc Delivery vector carrying a gplH deletion cassette (ΔgplHc) This study
Oligonucleotide Sequence (5’ to 3’) Characteristics
pepOF GGTACCTGTTCAACGCGGCCAGAGCGTCATTGGTCTCGGCCA KpnI
pepOR TTAATTAATGTTGCAACAGCTCCCTGATCCGGATGTCGACGTGCTTG PacI
pepIR TCAGCCGTCAAGAGCAAAGCTGCCGTTGTCGTCATCGAACGGGTTGAT SOE PCR
pepIF CGACAACGGCAGCTTTGCTCTTGACGGCTGAGTCAAATAGTCTGTTG SOE PCR
pepF CTGCAGTGAACAGCCGGGAGAAACGT PstI
pepR AAGCTTCCCAACAGACTATTTGACTCAGCCG HindIII